Friday, January 21, 2022

A Return

I arrived. The warm heart. The dark heart. A country so far away and made to sound so exotic that it might exist in another reality. A dismissible reality. There are some freshly paved and widened streets. There are more buildings and more cars, but mostly it is unchanged. A short distance from town the edges of the two-lane highways remain eroded. At points the bites taken by years and seasons of rain have left the road just wide enough for two vehicles to pass traveling in opposite directions. Men in threadbare suits ride single gear bicycles along the tattered edges. Do they pray with the sound of each vehicle approaching from behind to overtake them? Or has necessity made them fearless? 

 There are the sounds I hadn’t remembered to miss. Crickets and frogs at night. The purring of ngumbi wings hitting my window, their spasmodic fluttering imitating breathing or soft steps in gravel. They are drawn to the light on the khonde and then crawl under the door. Just fluttering now against the frame, in the ditch formed by the groove of the sliding door. They are there fluttering their wings off. In the morning I will find their inert bodies littering the khonde and sprinkled over the floor closest the door. Then there is the bark, no, the stuttered cough of a dog from a distance. I can hear the leash tight around his neck. Drifting to sleep I remember the man with the security company. I once walked through his yard where he kept the dogs and turned quickly away from a man beating one savagely. “They need to be mean” I was told. So, these men, working for less than would feed their families, beat the dogs. I wondered what happened to the hearts of the men. Where else were they now capable of rationalizing brutality? Or were they simply harnessing and turning their own daily passive brutalization on the dogs? I was only slightly surprised to later learn that the company owner was a pedophile. He played the role of the beneficent uncle well. In truth, it was the dependency he savored. The dependency of his siblings and his community, that kept their mouths silent as he took young girls to his bed. Who would want to upset peace and stability which merely demanded the sacrifice of a few young virgins? And, who to call? What force of justice might come to rescue the girls, when their own families consented to their sacrifice? 

 “Madam” they call me. Excessive deference to the entitled. In the beginning, even my mother and father-in-law would say madam to my light skin and blue eyes. Here there is still permission to remain comfortable with just a little ordinary racism. No one needs to stand on guard against their own implicit biases. No one will call you out. You may allow them to comfortably ooze out around the edges. Egos buffed with soft microfiber cloths “madam” “madam”. You may request your house boy to wear white gloves and stand to the side of the table as your guests eat. You may gently scold him with a look when the wine bottle slips from his gloved fingers. Afterall you are paying him well, and you are paying his daughter’s secondary school fees. He is so grateful. Without you, where would he be?

Monday, February 22, 2021

For the Love of Craig

I met my brother in 1980 on a cold January day at a foster home in Detroit. I had been waiting for him as far back as my four-year-old memory extended. I remember the joy, the anticipation, and the immediate sense of protectiveness seeing him among the other children in the house. Later, I remember him on the car ride home, his little blue hat and scarf meeting to obscure my view of his sleeping face. No one knew then that inside my peaceful 10-month old brother was a dormant force which would eventually claim his life. Our siblinghood took off from there. Energetic was a euphemism for his behavior in childhood. We played. We fought. We found our own paths. We grew in proximity, together and apart and together again. I moved across country for college and hardly looked back. I traveled the world, attended nursing school and became a midwife. He stayed in Austin, where we were raised, worked as a mechanic tec in local garages. I found my joy being with women, listening and supporting them through the adventure of birth. He found his with grease on his hands, deep in the mechanical bowels of cars. When he was in his mid-twenties, I started to become aware of something changing him from within. He twitched when standing or sitting still. I saw him awkwardly kick out his leg when bending to pick something up. He said he had back pain. I left for Africa. When I returned home for a visit, he was living with our parents. He had failed to tighten something important on a car and lost his job. He dropped things. He banged things. The twitching worsened. His toes moved as though they were playing the piano. People around us whispered accusations of drug use. He denied it. I made a long list of neurological diseases and started crossing them off. I requested his medical records from the various doctors he had seen over the previous decade. We searched for his birth parents. We found the death certificate of his mother. She had died at 40. He was 13. Typed on the line beside “Cause of Death” sat the ominous words “Cerebellum Degenerative;” not a true diagnosis but a clue. I returned to Africa. I had my first baby. At that point I had been a midwife for seven years. I had helped hundreds of women during their births. My midwife told me that labor was like a wide river that you had to cross. There were women on the other side cheering you on, but the journey was yours alone. It was hard. It was amazing. I reached the point when panic threatened to through me off course. I had incredible people with me cheering me along and I made it. I kept my eyes closed for hours but whenever I reached out my hand, someone grabbed it and steadied me. A few months later our dad took him to a neurologist who, after an hour’s evaluation, said he thought it was Huntington’s Disease. My brother, who rarely found a reason to be online, spent hours in front of the computer, pouring over stories and statistics which he synthesized and reported stoically as an assortment of lurid and distressing facts. · The life expectation for Huntington's patients is 10-15 years after the onset of symptoms · Huntington’s patients often die from choking, suicide and pneumonia · Huntington’s is known as the Dancing Disease, it is also often called the cruelest disease · If one parent has it, the child has a 50% chance of inheriting it · The course of the disease experienced by an affected person is often similar to that experienced by their affected parent · Huntington’s Disease is caused by an abnormal number of repeats of the CAG trinucleotide on the HTT gene. CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG These facts registered viscerally. I watched him and suddenly I could hear his demon laughing CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG. On August 31, 2011 a social worker wearing an uncomfortable smile in a room full of people named his demon. Forty-one laughs. That was the only time I saw him cry. Knowing made nothing easier. He was 32. Life continued, at that time mine was mostly in Africa. During my visits home I watched the demon beat out its own rhythm in his body, transforming his walk into a grotesque dance to silent music, arms flying, legs stepping high, body careening wildly. I saw the holes punched in the walls, made when the demonic force would fling him unexpectedly across a room. More than once I heard the thuds of his body as that force shoved his muscular six-foot frame down the stairs or knocked him over in the shower. I saw the bruises on his face and cuts on his arms from the beatings he never knew were coming. I watched the demon throw his food on the floor at the last moment as he lifted his spoon to his mouth. His room was moved downstairs, grab bars were installed. While I was home, I helped him eat and shower. He stopped reading and talking about Huntington’s Disease. He was living it. His depression was dark and I did not know how to add light. I returned to Africa. I had another baby. Labor was still hard. My midwife whispered in my ear, “Don’t be afraid.” My husband brushed my hair and rubbed my feet. My body felt it might tear in two and then our baby came gently into the world. At some point Dad knew my brother could no longer live at home and he was moved into a nursing home two hours from Austin. The transition was difficult. He was angry and the facilities (he moved 3 times) always struggled to care for him. He was not like most of their other patients. He was young, and mentally alert, and unwilling to submit to routines. Over time his speech deteriorated. It took effort for him to form words; communication demanded time and patience from those listening. Those who were short on patience assumed he was demented or developmentally delayed, and in turn, he would resist their care with everything he had. Those who had patience were rewarded with his elusive smile. Over time he walked less and less. His sentences gradually shortened to one or two words. Even “yes” and “no” became difficult to understand. I returned to Texas in 2014 with my family and saw him more frequently. I would tease him to see a smile. I would take him outside, light his cigarettes and hold them while he smoked. (When he entered the first nursing home, he resumed smoking after a ten-year break. He said the big H would get him before the big C.) I would cut his hair and wash his face. Apart from “yes” and “no.” He would say, “Thank you.” Every time I offered him a bite of food, he would say, “Thank you.” That always hit me in my heart. In 2017 he moved to a nursing home in Austin and dad started visiting him daily. I visited weekly. In early 2020 he lost his voice entirely. They gave him a speech device. He could touch, “yes” or “no” and phrases like “I want to smoke,” “I miss you,” and “I want thickened juice.” Swallowing was a problem; each bite and sip held both life-sustaining and life-threatening potential. The violent coughing fits from mis-swallowed sips instantly brought tears and fear to his eyes. In early March they told us they would be closing the nursing home to visitors indefinitely due to Covid. That night I came straight from work, I punched in the security code at 9pm and made my way to his room. I cut his hair and his nails. I straightened his room while he slept and kissed his forehead. He would be 41 in a week. In the time we couldn’t visit I thought about him and his life, about the hardness, the misunderstandings. I thought about his birth mother, Margaret Pohl. She was 28 when he was born. The adoption was closed, but our mother knew that Margaret had had a hard time giving him up. The story was that she dropped him off and returned to retrieve him several times from the foster family before she finally left for good. She must have been symptomatic. She must have known. She must have had a parent who suffered the same. She must have witnessed the disease. She must have struggled with love; wanting to keep him in her arms and knowing that if she did, he would witness her personal accelerating tragedy and ultimately end up orphaned. I imagine she prayed that he would be adopted into a loving family. I wonder if that hope gave her comfort through the years spent fighting her unwinnable fight. I wondered if we did right by her. She would want him to have a peaceful death and leave this life loved. I also thought of Judith and Maggie, two guiding lights for me. Midwife and hospice nurse, both in their 70s, dear friends who spoke of the parallels between caring for those entering and leaving this life. From March to August Dad and I saw him over video calls and talked to the nurses. His weight dropped from 141 to 132 to 125 to 118 to 114. I worried that he would die alone. We prayed for a good death. On August 31st the facility called to say his we could visit, his weight was 105, they thought he had days left. Hours later the hospice nurse said, “Come now!” Dad and I arrived together. His head was tilted back over the pillow, his mouth gaping, his eyes open staring at nothing. He was skin pulled over bone. I kissed the familiar scar on his forehead. I felt the worlds touching. As I held his hands, his purple fingers weakly squeezed mine. Dad sat at his side with his hand on his arm. We called the priest who came and blessed him and prayed. I thought of laboring women moving through transition. I thought of my experience. I dimed the lights, turned on soft music and the diffuser. He tried to adjust himself and I saw the anxiety in his face. An aide helped me straighten his body and his tension eased. I brushed his hair. When the anxiety creased his brow again, I whispered, “I love you” in his ear. The journeys of birth and death mirror each other; they provide the punctuation and symmetry of life. For both, there is no option but complete surrender. Both must be traversed alone, but both are easier completed with hands to hold. I felt swept up into an all-consuming love. In the same way I know a woman will make it through, just when she feels her body will break in half, I felt certain this was a transition to something good. He needed us to keep him steady. “You will be okay, Craig, relax into the love.” We sat there holding him as his breathing slowed. And then he was gone. I put my ear to his chest and kissed his scar one last time. He died August 31, 2020.

Monday, September 21, 2020

My Brother's Demon (July 2017)

The US was an adventure all its own this time. The plan was our usual summer routine – we would live with my family, I would work full-time in L&D for five months and Clement would stay for three months. When we pulled up to the house, the sight of my 32 year old brother moving spastically behind the lawn mower informed me that things would be different.

Over the past several years my brother’s body has been changing. I first noticed his constant fidgeting and occasional spastic movements when I came home in 2007. He saw a neurologist in 2008 who told him all was normal and Craig explained his strange walk and shiftiness as a coping mechanism for his chronic back pain. Over time he began dropping things more frequently but the insidious change made it easy to believe he was merely inattentive. In 2010 when I came home, it was clear to me that a still unnamed demon was claiming more and more of my brother. I requested copies of his medical records from all the physicians he had seen over the past ten years – several general physicians, one pain specialist, and one neurologist. While my brother hunted for a job as a mechanic - which I saw as a sad futile task, imagining what a prospective boss might think as my brother walked into an interview - I tried to enroll him in a medical assistance program for the indigent, and with less than $2 in his bank account, he qualified. We took the first available appointment for three months out.

In one doctor’s note I read that my brother told the physician that he would try to get information about his birth parents. When I asked my brother what he had done, he told me he had not gone further than asking our parents if they had any information. My parents adopted my brother at the age of 10 months. A social worker initially told my parents they were unlikely to receive a child - because they were old, they already had a child, and they were an interracial couple. When they found my brother, an active toddler who also happened to be biracial, they were overjoyed. It was a closed adoption in 1980. Craig and I filled the paperwork to search for biological relatives and after several months an envelope arrived. The agency was unable to find anything apart from his birth mother’s death certificate. She had died in Detroit in 1992 at the age of 40. At that time she was living in a nursing home with no family listed. She died from a heart attack but also suffered from “cerebellum degenerative.” The news was a blow for my brother. He would never meet the woman who had brought him into the world. Even if he had not previously thought much about her, now she was real. She had a name. He knew the name she had given him at birth. He knew she had died alone when he was 13. He became quiet and sullen.

For my part, I became obsessed with the “cerebellum degenerative” on her death certificate. We went to the first appointment hoping to meet a physician who would refer Craig to a neurologist and were told that the doctor was out for the week and that we would have to reschedule for the next available appointment, two months out. That appointment never happened due to another conflict, and then I was on my way back to Ghana. Craig’s enrollment in the medical assistance program lapsed. A few months later our Dad took Craig to a neurologist and paid for the visit out of pocket. A second MRI was ordered. During the result visit the neurologist spent an hour and a half with my brother and father, reviewing the past medical records, the MRIs, the death certificate, and conducting a thorough exam. He told them he suspected Huntington’s Disease.

Huntington’s is a genetic neurodegenerative disease. A person with one affected parent has a 50% chance of inheriting the abnormal repeat cagcagcagcagcag on a certain gene. When Craig told me, I imagined a demon laughing, “cagcagcagcag.” Any person with the mutation will eventually become symptomatic, usually in their 40s or 50s. People generally survive 15-20 years after they become symptomatic. Those who become symptomatic earlier generally experience a more aggressive form of the disease. Huntington’s was previously known as “the dancing disease” due to the characteristic chorea or exaggerated movements. Uncontrolled movements become more and more severe while the muscles simultaneously weaken. The person gradually loses the ability to walk, to speak, to swallow. Craig told me that the most common causes of death are choking, infection, and suicide. A person without the mutation cannot pass on the disease. Craig has a daughter.

Due to the prohibitively high cost of genetic testing and the possibility of Craig needing several genetic tests, following a negative result for Huntington’s, the neurologist advised us to try to get the medical records of his birth mom before doing the genetic test. We were unsuccessful at obtaining medical records so when I returned to Texas this year, I called the genetic counselor at the center for movement disorders in Houston and scheduled an appointment for the genetic test.

My mother is also entering a new challenging phase of life. She turned 80 in October and though physically youthful, is living with significant dementia. People and tasks that were once familiar and simple are now unknown and challenging. She no longer drives or cooks. A thought will come and pass in the same moment. The direction of an act is lost on the way to carrying it out. My beautiful joyful faith-filled mother has lived so that her light fills spaces and hearts, but when we arrived I found her light muted by confusion and frustration.

Thulani was her medicine. During our months in the States, she fell head over heels in love with him and in his presence she was bright and alive. Every day she would move with him around the house, showing him all the pictures and art on the walls, turning lights on and off in the rooms, moving outside to look at flowers, and finally ending their daily tour near the statue of St Francis out back, helping Thuli touch the birds on his shoulders. She showed Thulani how to knock on doors, how to open and close drawers. One day I found them digging together in a planter. I could see the joy they both received in touring the world with fresh new eyes. She told me one day, “You know I love Thulani more than you,” and I laughed just so happy that they had each other. In her love for her grandson, I saw her love for her daughter, and imagined her has a new mom. She wanted him to experience the world in her arms, whether that was looking at the sky and the trees, or eating pasta and sausage and sipping Dr Pepper at four months. I had to stay alert. By the time he could move in a walker he would run to her with his arms outstretched in the morning or search for her in the laundry room when she was not around. I worried about their separation.

In August Clement returned to Ghana. Mom, Dad, Craig, Thulani and I made two trips to Houston for Craig’s genetic test and result. On August 31st 2011 in the presence of a psychiatrist and medical intern, the counselor clumsily delivered the positive result with a smile. The medical support team then sat awkwardly watching as my brother sobbed. We left. Afterwards, Craig spent hours online reading articles and watching videos about Huntington’s Disease. This was his demon, the one hiding in every cell. For years it was there, invisible but silently laughing “cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcag cagcagcagcagcagcag.”

So this was the new home, a home of transition, some loss, some sorrow, some change, some joy, and love. My father, at age 76 still works and would kindly tell anyone concerned that they are doing well, that they are managing. We would disagree about the managing part. I felt everyone could do with better nutrition and more support. At one point, Craig decided he could meet his caloric needs best by blending huge wedges of chocolate cake with raw eggs and milk (he must consume 3000 calories daily to maintain his weight). Mom would say she was hungry and then the next minute, tell me she had eaten. The house needed cleaning. They all needed rest, especially dad. Dad would tell me that things would work out, that he was changing his routine to care for them. We all did our best.

I filled out the paperwork for my brother to get on disability. I made phone calls and spreadsheets. I bought Craig manageable clothes and shoes (no more buttons, zippers, snaps, or laces). Every day rushing to squeeze in my year's contribution of support into my remaining days in Texas. Dad hired someone to install grab bars in the shower and bought a special chair for the table. We all went to support meetings for Craig. We prayed. I did a lot of worrying. It was exhausting and overwhelming. I irritated my parents with my “need to take over.” They assured me they would manage and that we must return to our life and to Clement in Ghana. At the end of October, mom and dad drove Thulani and me to the airport. Mom and Thulani and I all cried at our separation, perhaps all for different reasons but all because of love.

Monday, December 10, 2018

Tonight

I am waiting with a family for their daughter. I found the mother tucked into a labor bed wearing a calm expression and breathing with quiet force through the pain; her husband sitting in the chair beside her. Their children he said, not allowed in the labor ward, waited just outside. Three girls 11, 8, 5, and 1 boy age 3. The children have been waiting for hours. It is now 10pm. I tell him the baby may still be hours away, the children should go home and sleep. They do not want to leave without their parents. When the baby is born they will go home together.

I pass by to meet them. They are not fighting, just quietly waiting; the oldest on a phone, the baby boy dipping french fries in ketchup. Their father says they never want to leave him. They traveled from Honduras to Mexico by bus. They would sleep sitting upright body against body. They stayed in Mexico for some time. When he would work clearing land and walk all day, they would follow. I imagine the little boy sometimes on his father’s shoulders, sometimes trailing behind, always watched by sisters. Moving as one. Love binds. The father says they live the life God gives. This is the first delivery in the US. I imagine another setting, her children around her, their baby tumbling out into the warmth of the family’s enkindled love.

I imagine my own small people snoring in quiet whispers, three beds in one small room, street light and tree shadows dancing over their forms; arms tossed across pillows, mouths softly open. My heart hurts with love.

Tuesday, March 20, 2018

Now

In 2018 I am in Texas with my Malawian husband. We are here raising three boys. We left Africa to be close to my parents and my brother. My mother died last January in 2017 after a long slow decline. My brother is dying slowly. My father is bearing witness and spending time with his grandsons.

My brother's Huntington's disease has progressed transforming him from a man who loved riding motorcycles and fixing cars, to someone whose toes seemed to play an invisible piano in 2007, to a man whose body dance eerily and uncontrollably in 2013, to a man who at age 38 lies in a bed in a dark room in a nursing home for most hours of the day. He can move his body with powerful spastic energy going from an inert form to upright in a second, but he cannot balance, he cannot walk, he cannot feed himself, he struggles to swallow, he struggles to talk. His mind remains clear. He enjoys smoking and pie. Recently when I asked him if he was ready for a DNR (Do Not Resuscitate) order to be placed on his chart he said "I have seven years" in an unusually clear voice. When I asked him what he enjoyed he said, "smoke." I said, "And, what about MY visits?!" feigning offense and he smiled. I'll take that, coming second to cigarettes and getting the occasional smile. He has very little outside of a desire to live. He has his TV tuned to a channel that is one long continuous Law & Order marathon. His neighbor is an elderly man with dementia who bursts into loud conversation with unseen friends periodically day and night. One thing my brother has going for him now is that he is so easy to love. This was not always true. But now, I feed him his pie, he says thank you after each bite and I feel so much love.

Monday, March 19, 2018

What is more powerful than a strong voice yelling loudly?

...A story. Stories softly told. Personal. truthful. told to listening ears. It seems so many people are standing on their own personal embankment, yelling into the roar of weather created from countless shouting voices. Through the din, all that reaches anyone is anger. It's easy to get there. Sometimes I stand firmly on my own stone, and lean into the noise, fists and teeth clenched, brow furrow, pressure surging from my wounded heart fueling anger. And, for me, this is it... my wounded heart drives me beyond defenses to lash out against weapons I believe you possess. But, in a quiet moment, when I look deeply and calmly into your eyes and you into mine, all that remain are reflections. Ours.

Saturday, March 23, 2013

Blessed

During my pregnancy I had imagined myself in our little flat laboring and delivering our baby all alone. Clement was supposed to be assigned to a district several hours away for a six week period right around the due date and I was struggling to find a midwife. I refused to go to a hospital. Now, in retrospect the harmonizing of details (both anticipated and unanticipated) and the beauty of the real story are powerful reminders of how love infiltrates all aspects, large and small, of our lives. Fortuitously, the timing for Clement’s fifth year district placement was changed to July and three friends from the States boarded planes to cross the ocean and the thousands of miles separating us, in order to be with our family during the birth. Blessed.

My due date was February 28th - exactly the same due date as Thulani’s. Thulani was born on February 18th so I imagined I would again deliver early and asked my friends to come for the two weeks before the due date. I had February 18th in my head. I wanted to have a couple days with Sarah and Jess, to be a tour guide and enjoy them prior to the birth but then deliver early enough so that they would have time to travel and see some of Ghana. (What a shame it would be to come all the way and spend it sweating and waiting in our flat.) Judith had come for Thulani’s birth and I knew she was not as interested in sight seeing as just being together and holding a newborn. I did want to give her at least one night’s rest this time (I had delivered Thulani just hours after she arrived in Ghana and walked through our door in 2011). Sarah and Jess bought tickets for a plane arriving on the 14th and Judith was scheduled to arrive on the 17th.

Sarah and Jess arrived without incident. On the 15th we toured the market. We bought batik cloth and sent it to a tailor for dresses for their girls; we bought beads and food; and had a good time thoroughly exhausting ourselves. On the 16th and 17th we rested and ate (they cooked amazing food). No contractions. Judith arrived in Accra on the 17th but we were informed that there was no jet fuel and all local flights would be canceled for the next four days. So, Judith would have to take the six hour bus ride from Accra to Kumasi. Bumps were smoothed by a dear friend in Accra who met her at the airport and took her to a hotel. On the 18th Judith called at 6:30am to say she was already on the bus, Clement went to class, and the rest of us ate a leisurely breakfast while Thulani opened birthday presents. At 10am we decided to go for a swim at a nearby hotel. It was a great morning. We were the only ones at the pool and all of us appreciated the cool water. As I floated and swam languidly, I started feeling a few painful contractions. They got my attention, but were not strong enough to make me grimace, so I thought we could keep swimming. After one or two that were a little more impressive Sarah suggested we return to the house. Around the same time Judith called to say she had met our friend Caterina and that they were on the way from across town.

In the taxi home, the contractions completely stopped and I started to regret making everyone leave the pool. But, once home they started up again, so I tried to keep physically active to keep them coming while Sarah and Jess prepared lunch. I texted another friend, Kathryn, who wanted to attend the birth and told her “maybe” today. I called Clement to tell him to be on standby, then reconsidered and told him just to come home. Judith and Caterina arrived and we ate lunch. Kathryn walked in and I started to worry about everyone sitting around staring at me, waiting for action that wasn’t coming. At one point my landlord, who is an obstetrician, came by and asked to speak with me outside. He offered accommodation for my friends in rooms near his hospital and offered to provide me a private delivery room. I declined his kind offer and didn’t mention that I was already contracting.

Clement walked in the door and then the action started. By 2pm the contractions were demanding all of my focus and Kathryn called Dr. Rex Jokoto (the obstetrician who agreed to be on call during my labor) to let him know active labor had begun. Sarah listened to the heartbeat, which sounded strong and clear through contractions. Everyone was quiet and attentive. Then, the caretaker (a very sweet woman) knocked once and walked in with a carpenter. They walked past us and headed straight to the kitchen to take measurements for cabinets. We have been living in this flat for 18months and cabinets were promised before we moved in but apparently the carpenter was available that day or perhaps my landlord decided that was the day. My contractions slowed way down. I wanted them to get what they needed, knowing that that might truly be our only chance to have cabinets. Everyone exchanged quizzical looks and I had to laugh. They left and the contractions resumed. My feet were massaged, my shoulders rubbed, and my hair combed (my request). The harder they massaged, and rubbed and combed the more manageable the contractions.

Thulani participated in everything. I have a nice video clip of him rubbing my feet with Clement during a contraction. Every once in a while he would ask, “Mommy, Are you ok?” and I would smile and assure him that I was. I never worried about him. There were so many loving friends he knew to take him on their laps and softly whisper in his ear that I was working hard or play with him for a minute. He stayed by my side throughout.

As the contractions escalated I got into a tub of cold water. Sarah, Clement and Thulani squatted beside the tub, rubbed my arms and placed cool cloths on my head while I labored. My dear friend Ethel arrived. I got out of the tub and leaned on Clement for a few contractions that really took my breath away, while Judith squeezed my hips, and Thulani held a cool cloth on my legs. As soon as I could manage, I walked back to the couch. Charlene – the 10 year old neighbor who wanted to see the birth – arrived. I got on my knees on the floor and leaned into Clement’s lap. Thulani sat next to Clement and everyone else encircled the three of us. I had two more contractions and then felt a strong urge to push. With one push a head full of dark hair delivered. The body followed quickly with a second push and Judith handed me the baby between my legs. We were expecting a little girl and everyone started saying “she . . . she . . . her . . ” until Sarah gently asked, “Is it a girl?” I checked and saw boys’ plumbing between little pink legs. Everyone cheered and erupted into laughter.

After a few minutes, quiet Thulani piped up, “I want to touch him” and he gently touched the baby’s head. After the cord was cut the baby was wrapped and placed directly on his lap. My sweet birthday boy was the first to hold the baby. While Sarah and Judith repaired a small tear, Rex called Kathryn to check on the progress, and was shocked to hear that after 2 and a half hours, the baby boy was out and he was “off” call. Delivery time was 4:35pm.

It was such a quick labor. The sun was still high and bright. I felt full of energy. I took a shower and then drinks and food were shared and the rest of the neighbors poured into our flat to shake my hand and see the baby. The caretaker returned with her two adult children and laughed about what she now realized she had done (she also said she had called to inform the landlord, who was equally surprised). Two college students from next door, Charlene’s older sister Emma, her brother Joshua, their grandmother, Ethel’s husband and their two year old daughter also arrived. Our place had never been so full. Everyone sang happy birthday to Thulani while he held the baby. At the end of the song, Thulani held up both hands with fingers spread wide and while wearing a giant smile said, in a loud excited voice, “a BIG birthday present for Thulani!” Indeed, a BIG birthday present, and a wonderful birthday for my two beautiful boys.

It took us almost a week to come up with a name for our new addition and finally we settled on Tau Alexander Chiwaula. Born 18 February 2013 at 4:35pm in Kumasi, Ghana weighing 7lbs 12oz and measuring 19.75in.

Thulani’s birth was such an amazing experience that I thought it might overshadow the birth of our second child but Tau’s birth was equally special and a true manifestation of perfect love. The gratitude we feel as a family is overwhelming and there are so many people to thank.

Thank You,
• Judith, Sarah, and Jess for your amazing friendship; for coming all the way to be with us and giving us such loving care before, during, and after the birth
• Sarah and Jess’ families – their husbands, Emmanuel and Matt, and daughters, Zelda, Charlotte, Sadie, and Julia – for sharing your wives and mommies for two long weeks and sharing your books and dolls with Thulani
• Judith’s boss and her community of sisters for approving her travel and for your prayers
• Caterina, Kathryn, and Ethel for your loving presence during the birth, for food, drinks, extra mattresses, sheets, and taking care of many other details
• Charlene and Emma for your love of Thulani and all the little ways you helped me prepare for our guests (mopping floors, painting shelves).
• Charlene’s mother Angela and grandmother for providing Sarah and Jess a room in your home once Judith arrived
• Faustina for taking good care of Thulani and helping with preparations
• Celia for meeting Judith at the airport and making sure she got to us
• All our loved ones across the continent and the ocean for your prayers for a safe delivery and for sharing in our joy



In the end, Sarah and Jess were able to tour Ghana a bit – visiting Lake Bosomtwe, Cape Coast Castle, and Axim on the Coast – before returning home. Judith got her one night of rest before the birth. She also visited Cape Coast and then returned to Kumasi for plenty of snuggle time with Tau. Everything passed as quickly as a beautiful dream, but unlike a dream our memories remain vivid and bright. And, of course we have a lingering bright-eyed pink-cheeked squirming grunting growing sunbeam who reminds us constantly that it wasn’t a dream at all.


Thursday, December 13, 2012

In Search of a Midwife

I am 37 years old. I am an American certified nurse midwife. I am living in Ghana. I have lived in Africa for the past 8 years. I am married to an African. I am teaching nursing and midwifery. I am pregnant with my second child. I am looking for a midwife.

This summer I managed to squeeze a few video clips of beautiful home births into my class of high risk labor and birth. Even though my students had all been practicing midwives for 3 to 6 years, based on my experience in the labor ward, I doubted whether they really “knew” normal birth. When the video started, featuring a half naked laboring woman swaying and moaning in her husband’s arms, the drowsy eyes opened wide, slumped postures became erect, and lots of excited whispering filled the room. There were smiles and cheers when the baby delivered, and laughter and sighs when the new father held his daughter skin to skin against his bare chest. When the video finished, I asked the class, “So what did you think?” There was some quiet giggling and more whispering and then my best student in the front row said enthusiastically, “That was the most romantic birth ever!” The entire class erupted in joyful laughter. When I asked whether they would like to deliver like that there were only nods and smiles.

I know many midwives in the West who encourage women to birth like indigenous women everywhere – meaning fearlessly, trustingly, in response to the needs of their bodies. These midwives are trying to tell their clients that birth has been happening since the beginning of time. Birth happens every day, every minute all over the world, and no matter how removed your daily life and mind are from the natural world, your body has its own wisdom. They are saying, “I am here to support you but your body knows what to do. Listen and let go.” Many women respond to this and feel reassured. It is always good to know that you are not alone that many others have gone before you. But, the irony is that even indigenous women are forgetting how to birth like indigenous women.

Another day in my class when discussing why women labor in their villages far from the hospital, far from emergency care, I asked my 45 students, most of whom were mothers, how many of them felt they were well cared for during their birth experience. One student in the front row raised her hand and said, “But of course we were, we are midwives and have more control over our birth experiences.” She hadn’t looked around to see that her hand was one of two hands raised in the entire classroom before she spoke. When I drew her attention to that fact, she was surprised. I was also surprised. If midwives, delivered by their co-workers – people they are with every day, working, and laughing – still report that they were not well cared for during labor and birth, what about women who are uneducated? What about women who have no advocates in the labor ward? What about women who are just impoverished pregnant women in need of a place to deliver safely?

In the US labor rooms recently immigrated Latina and African women are typically quiet and stoic. They don’t scream or struggle against the process; they submit. Clinical staff often make comments about these women being “strong” and “easy to care for,” “they are not ‘spoiled’ like middle class American women.” The times when I asked these women about their birth experiences in their native countries, I heard stories about nurses and doctors who yell at them and who occasionally hit them. They almost always told me that they were warned by female relatives to be silent, obey, and endure. From their stories I realized that these women are not responding and listening to their bodies, they are rather responding to fear. Even though the behavior may be similar, there is a significant difference between being well-prepared and open to the process, and being more fearful of your care-givers than the pain.

I have seen many of these births in Latin America and Africa. In these environments the midwife seems to prioritize order – all women quietly lying on their sides laboring in one room – over all else. There is a formula for birth. Averting danger and chaos means close adherence to this formula and any deviation causes the volume of voices to rise and rebukes to shower on the head of the offending woman. Some parts of this formula are indeed important but the problem is that it is a formula and is applied indiscriminately; there is no room for variations of normal. The objective is a live baby and live mama (period). All women should labor on their sides quietly, then all women should move to the delivery bed when they are completely dilated, then all women should hold their knees and push. Episiotomies will be given for first time moms, for any delay, and to prevent tears. Vaginas are well sutured and manual evacuation of the uterus is done for just about any bleeding after the placenta. I have never met a midwife who was an unkind person, who could not speak passionately about the suffering of women. Most midwives I know are mothers. At the same time, I know only a few midwives in these settings who respond to the suffering of an individual woman with true compassion; who are truly able to see the woman and respond to her in her unique situation. Labor wards in the US have many of their own problems and although staff do not yell at patients, quiet women who lie on their sides and deliver on their backs are generally preferred.

It is now my turn to find a midwife again. I am seven months pregnant with my second child. My son who is now 2 was born at home in Ghana. Two dear friends traveled all the way from the US to be with us during the labor and delivery. Apart from early childhood, I cannot think of a time when I felt more supported and surrounded by love. My husband, my two midwife friends, and two additional dear friends were present. Each time I reached out my hand, it met another strong hand to hold. When I was thirsty, water was brought to my lips. When I was fearful, soft firm reassurance was offered. My son came quickly and smoothly. During the labor I walked around, I got in the shower, I lay on my side, and finally I delivered him on my knees with my arms around my husband’s neck. It was an amazing experience; an incredible blessing. It is also a lot to expect someone to come halfway around the world to catch your baby. This time I thought I would try to find a Ghanaian midwife to be with me during the labor and birth.

I asked the obstetrician who was “on call” for me last time and has agreed to be on call again this time about a midwife. My question brought a quizzical expression to his face. Even though he supports home birth of low risk women he said he didn’t know any midwife who was comfortable with out of hospital births unless he himself was also present. He was kind. I’m sure he immediately noted my surprised expression and said he knew that was not what I wanted. He promised to ask around.

I called one of my students. She was excited to see my big belly and promised to get me a very good midwife. She immediately suggested someone who had recently retired, “a very good midwife” she said again, meaning experienced and kind. When I met this midwife I explained that I was looking for a midwife who would be comfortable delivering me at home in the presence of my husband and friends, that I would like to walk around and probably would not deliver on my back. The light in her eyes dimmed. She said in her 30+ years as a midwife she had never seen a birth except in the lithotomy position. I asked about traditional birth attendants, she said even they deliver women in the lithotomy position. She said she would be willing to learn if I could teach her but then she also started mentioning other obligations and saying things like, “God willing, I will be free.” I knew she was uncomfortable.

A few days later my husband Clement, who was at that time doing his obstetrics and gynecology rotation, shared a taxi with a senior midwife from the hospital. They began talking and he explained that I was looking for a midwife to deliver me at home. He told me later that he had hoped she would spontaneously mention someone or make a suggestion. Instead he was met with silence.

I asked a friend who heads the family practice residency program if she had any ideas, knowing she had plenty of contacts. Her suggestion was for me to deliver at a private clinic and “explain my wishes.” I would not want a midwife in my home wearing a nervous expression trying, however gently, to get me to lie down or turn on my back. I know labor is difficult and I know I can have a good delivery; I just need someone who will monitor me and my baby and support us through the process. I do not need someone trying to control the process (as long as it is normal). From my search I have realized how rare it is to find someone like this. In my home I could ask my husband to intervene if the midwife became too much of a distraction or domineering force. Or, I could move to another room, but no matter what I explain in the private clinic ahead of time, once I enter the door as a laboring woman I abdicate all my power. I am not ready to do this.

I wrestled with myself for a while. Am I the spoiled American demanding too much when other women are just fine with less? If so many other women submit to the process and just get on with it, why can’t I do the same? Then I realized that other women are not fine with less. Many women do not have a choice and many choose to take on the risk rather than submit. No matter how frequently they attend antenatal clinics and how much we strive to "put the fear of God" in them, almost half still choose to birth at home without a skilled attendant. I understand them. I am educated. I teach midwives. I have witnessed horrible births. I have seen women die from complications of labor and deliver. I know the risks. I would rather deliver completely unattended in my home than go to the hospital.

What happened to knowledge from witnessing and supporting natural birth? In our effort to eliminate risk have we also eliminated the wisdom guarded by midwives for generations, throwing the proverbial baby out with the bathwater? Have we forced the keepers of this knowledge so deep underground that few women now benefit from it? I am not a big woman, many people call me small, but my son was 4200gm (9lbs 2oz) and he came out in three pushes with only a superficial tear. I want to be clear, I am in no way arguing that all babies can be born vaginally or that all women can have easy births. There is ABSOLUTELY a place for emergency obstetric care and it should be readily available to ALL laboring women. I am personally very grateful to the obstetrician who will be on call for my home birth. Ensuring that all women have access to emergency obstetric care is a worthy goal that we should pursue until we achieve it, but in the process we should not eliminate the place for normal birth. After my son was born I was repeatedly told by physicians that they would never have allowed me to labor, that they would have sectioned me based on the estimated fetal weight. All I could think was, “Why?” And, “Thank God I’m a midwife who would never agree to that.”

My labor never deviated from normal. My son never experienced a moment of distress. I knew the midwives were monitoring us well so I never worried, I was confident that they would act if necessary. Why tell women you can’t do it or limit their attempt to do it by forcing them into a certain position? I feel confident and strong about birth in general but when I imagine myself without my husband, lying on my back, I feel fearful and unsure. I am not sure that I could deliver vaginally. Why do we as midwives, nurses, and doctors fear women who move, who are vocal, who deviate from the formula? I believe it is because we are quickly forgetting how to respond to them. We are forgetting how to support them. We must re-establish the space for normal birth. We must relearn normal labor and birth. If our international intentions to improve maternal and child health are genuine, our efforts must not stop at reducing mortality, we must also improve care. And by this I mean “care” in its full sense, not only access to emergency medications, and procedures, but the compassionate individualized responsive treatment of women and children.

I put out another plea to my midwife friends back home. One of the friends who came for my son’s birth will come again to meet my daughter.

Saturday, April 30, 2011

A Mother's View

Thursday Thuli took a four hour nap. I accomplished a lot and thought he was probably exhausted because the previous day we had run around town with Caterina and he had missed his an afternoon nap. Friday I put him down and noticed that I was once again able to get a lot done. When he finally woke Clement picked him up and said he was burning. I looked at the time - 3pm - and realized he had slept for five hours. We took his temperature and it was 103 under his arm. Clement’s final exams would start in a few days and he hardly had time to eat much less sit in a waiting room for a few hours so I called Caterina and she said she would be on her way shortly to take us to the hospital.

I imagined that we would spend a couple hours waiting to see a doctor, have a malaria test, receive medication, and return home. Instead, after paying we were led directly to the consulting room. I told the doctor that Thuli had a fever, was sleeping more than normal and had become quite listless on our way to the hospital. The doctor also noticed a slight bulging of his fontanel. He ordered a malaria test, a CBC, an IV drip, anti-malaria medication, and IV antibiotics. It took me a couple minutes to process that we were being admitted and then the gravity of the situation began to take root as a deep nauseating presence in my gut.

A nurse led us to the children’s ward and I wiped away a few tears as Thuli screamed when they put in the IV. (I have to say the nurse was very good to find his tiny vein under all that flesh.) They then led us to a crib which would be home for the next few days. The children’s ward at Tec Hospital (the public hospital located on the university campus) is smaller than the one at KATH - where I fulfilled my nursing registration requirements in Ghana – and also smaller than Kamuzu Central Hospital in Malawi but the set up is identical. The children’s ward at Tec consists of three patient rooms and a narrow room for the nurses’ station. In our small room there were eight cribs and two beds (for older children). Beside each crib and bed sat a small wooden chair for the mother and a small cabinet where she could store personal items. The ward had two doors, one opening to the main front hall and the other to the bathroom area, a stall with a single toilet and another room with a shower and a sink. A long screened hall with a bench flanked the ward and was used by the mothers and guardians during meal times and visiting hours. There was no place for mothers to sleep.

Caterina helped us settle into our bed and stayed with me a while to sponge Thuli and offer gentle reassurance before she returned to the house to collect essentials and dinner. That night there were six other sick children in the ward. All the mothers were consumed in the task of nursing their children. When I tried to ask the mother closest to me a question, she looked away and I realized that she did not speak English. I was too worried about Thuli to focus on any other details. Caterina returned with food and Osman, my Ghanaian nurse friend, also came by to check on us. Before she left, Caterina coaxed me out of the ward for a few minutes and encouraged me to eat while Osman stayed with Thuli. Once back in the ward, Osman helped me set up a mosquito net and then said goodbye.

I watched the other mothers prepare for bed, set up their nets, change into bed clothes (an exercise I found slightly comical since there was no place to sleep), brush their teeth, and then assume their positions for the night. Two mothers occupied the beds, one mother placed pieces of cardboard on the floor and laid down next to her baby’s crib, the others sat on their stools resting their heads on folded arms over the crib railing. I climbed under the net and into the crib with Thuli. It was just big enough to sit upright, holding him, and extend my legs. When the nurses rounded, they commented on my presence in the crib but I told them he had never slept alone and they allowed me to stay put.

It was a long night. I continually dipped the cloth in water and wiped Thuli. I watched the clock. I took his temperature. I prayed. The room remained brightly illuminated all night. Even hours after the first doses of the medications, Thulani's temperature soared. He slept on and off occasionally fussing a little with the cold cloth. The room was quiet but for an occasional cry and the soothing sounds from a mother. I dozed for a few minutes.

Caterina arrived first thing in the morning with breakfast and flowers and hope. She made me tea and sat with me while I ate. She sat with me while I waited for the doctors to round. She sat with me through my moments of panic. Clement arrived for a visit. I managed to express a bottle of milk and around 10am we left Caterina with Thuli while I went home, showered and took an hour nap. When I returned I found Celia and Katie (two other expats) at Thuli’s bedside. I relieved Caterina and inspected Thuli. First, I noticed he was even more listless than the previous day and when I took his temperature it was just as high. Then, I noticed that his IV had infiltrated and his poor little arm was three times its usual size and his little fingers were turning blue from the pressure of the tape (poor Caterina later told me that she had avoided even looking at the arm with the IV because it made her feel sick). I turned off the IV and Katie called the nurse. A couple young nursing students responded with a dull pair of scissors, so rather than wait any longer I ripped off the tape and yanked out the cannula. There was no reaction from Thuli to the manipulation of his arm.

I started sponging him again but he hardly stirred even when I touched the cold cloth to his abdomen (an action which previously made him cry). I sponged him fervently and felt myself quickly approaching the edge of sanity - feeling helpless, watching him suffer, wondering if the treatment was having an effect and what invisible assailant continued his vicious attack on my baby. I cried messily and felt the eyes of the other mothers on me. My healthy chubby breastfed two month old was not supposed to be this sick. I decided to submerge him in the cold water, since sponging him had had minimal effect. Katie filled one of my basins and I sat Thuli upright in the water and began pouring it over his entire body. After a couple minutes he opened his eyes and looked at me. Relief. I continued holding him in the water and talking softly to him. He gave me a weak smile (just the reassurance I needed).

Throughout our stay friends sent me text messages of encouragement and called with prayers. I felt completely overwhelmed at points by the suffering of my baby but I also felt completely supported and surrounded by love. Saturday night, an hour after giving Tylenol, I felt his temperature start to peak again and feeling myself start to panic I whispered a prayer for strength. Then, at 10:35, I felt the fever vanish completely for the first time. I continued taking his temperature hourly and though it continued spiking above normal limits it never again reached anxiety producing heights. That night the nurses refused to let me sleep with Thuli so I slept on the chair leaning over his crib.

Sunday morning. Easter. Celia arrived early to allow me another two hour break for a nap and shower. That day passed uneventfully. Ernest and Ethel visited. Dr Annie, from the maternal and child hospital where I had volunteered, also visited. Thuli had periods when he acted completely normal. That night though he developed a rash over his entire body and when my adrenaline began pumping I called Caterina and Smart who again offered reassurance.

As Thuli improved I was able to notice the other children and mothers around me. We had moved cribs on Saturday and the mother who was originally next to me was one who sat on her chair day and night. The nurse had told me that the baby was also only two months old, but compared to Thuli he was very small. He cried incessantly. He had an IV connected to his foot and a tube draining the contents of his stomach from his nose. Like me, his mother sat with a bucket of water and sponged him constantly. When she passed the cloth over his face he would lick at it furiously, like a man dying in the desert. She had another small child, a boy around two, who was constantly pleading for her attention and running underfoot. I did not know how many days she had been there before we came but I could see that her strength and patience and resolve and hope were severely weathered by exhaustion. Evenso, when her baby would cry she would pick him up tenderly and kiss him and whisper to him. Sometimes he was silent for a few minutes. She did not speak English and I did not see her speaking to the other mothers. Her face seemed impassive but her eyes contained deep sadness.

Sunday night she broke. Bent over the crib, she began sobbing. I immediately put Thuli in his crib and went to her. I put my hand on her shoulder and rubbed her back while she cried over her tiny sick thirsty baby who would not stop crying and her little boy who wanted his mother. I sniffed back my own tears now truly understanding what was at stake and all the love involved. After some minutes she gestured to his penis and shook her head, I asked her if the nurses knew and she nodded. I went to tell the nurse that she said he was not urinating and the nurse said that the boy had not passed stool for several days even after an enema and now was no longer passing urine. The nurse said that the surgeons would see him Monday morning. I went back to her and stayed with her until her tears stopped falling.

Her little boy had an intestinal blockage, most likely intussusception – a condition in which the intestines telescope into one another. Some cases resolve spontaneously, some cases resolve with an enema, and other cases require surgical intervention. If not rectified early on, the diminished blood supply to the affected bowel will eventual lead to bowel necrosis and then sepsis and death. If untreated, death will occur within two to five days. Three days had passed since we had arrived at Tec, I don’t know how many days they had arrived before us.

Monday morning the surgical team arrived early and the boy was taken from the ward. Several hours later the mother and child returned. I went to her and she smiled a smile of relief. The other women nearby told me that it had gone well. The baby had a large bandage around his abdomen and appeared to be stable – calm and breathing regularly.

The neighbor of our new crib also captured my attention, a young mother with a very tiny very wasted very lethargic little girl. The mother spoke English but she did not talk much except to her own mother and sister who took turns staying with her. Her husband came during visiting hours and told me that their daughter was two months old (exactly one week younger than Thulani). She had stopped nursing on the breast and so they brought her to the hospital but in hospital she became progressively weaker. She had a nasogastric tube and the mother expressed breast milk for the nurses to feed her daughter. I asked the father how many times a day she was being fed and he said four. I was horrified and told him that infants need to feed every two to three hours, I suggested that he talk to the doctor. Over the next couple days I noticed that the feeds increased in frequency. During the Monday morning rounds the young doctor asked how much the baby was receiving per feed. A nurse replied that they initially gave the baby 25ml at each feed but that it was currently up to 40mls. Again I was horrified to hear how little the baby was being given. The doctor then ordered 50mls per feed.

As Thuli improved, I saw no improvement in his neighbor. Her name was Kezia. Several times I noticed the grandparents looking over at chubby Thuli with sad smiles and I felt a terrible pang for Kezia’s mother who clearly also noticed their wandering glances and would occasionally turn to look at Thuli over her shoulder. She was so incredibly tender with her daughter, carefully bathing her, dressing her in frilly little dresses to cover her wasted body, wrapping her in a clean white cloth, covering her boney head with a little pink cap. Kezia barely moved. She blinked slowly. She never cried. She only occasionally made a slight hissing sound to clear her airway.

It is one thing to spend time in a ward as a nurse it is another thing to live in a ward for a time, fighting exhaustion, riding the emotional waves tethered to your child’s fluctuating health status and sitting next to other mothers hour after hour also suffering together with their children. It is a different experience to know the pain and fear associated with attachment to a fragile life and then to watch mothers around you hour after hour engaged in their private tender ministrations of love to their desperately ill children. It is painful. Yet as a nurse it is nearly impossible to accept that in certain situations you must only be a mother and must abide by the rules of that role in the hospital. I wanted to read Kezia’s file and discuss her case with the nurses and doctor but instead I could only ask the father questions and suggest questions he might pose to the doctor.

Monday night my exhaustion reached a new level. I literally woke a couple times during the night and could not immediately remember which country I was in or where I lived. At one point I was asleep on the bench outside when one of the mothers woke me to tell me that Thuli was crying. I went to him and began nursing. Through my haze I was aware of the nurses turning on the oxygen tank and after a few minutes I looked over towards the bed with Rashmu, the small sick boy, and saw one of the nurses pumping the ambu bag frantically with her left hand while holding something else in her right hand. I immediately put Thuli down and took over the ambu bag. Rashmu’s little body was already cold though a fire still burned in his head. I continued bagging for some time and started chest compressions but there was no response. He had no reflexes. The nurse said she could not auscultate a heartbeat. His mother watched from a few feet away. We stopped the resuscitation and his mother’s grief filled the room. She cried until her face was swollen. I hugged her and she held on tightly to me. After some time the small body was removed. The day began. Visitors arrived with breakfast for other mothers. Clement arrived with eggs and toast. Rashmu’s mother sat silently in her chair for a while and then slowly gathered her possessions and started walking out of the ward. Two other mothers took her bags from her and I ran behind to catch them with Thuli in my arms. I grabbed her hand and placed a little money in her palm. She started to say something then just hugged me and kissed Thuli.

That day more children were admitted and everyone from the original group, except for Thuli and his tiny neighbor, was discharged. The doctors decided they wanted to give Thulani seven doses of IV antibiotics and told us they would discharge us on Wednesday. No one knew definitively what illness tramped through Thuli’s body. One doctor thought it was meningitis, another thought sepsis, a third thought malaria. The initial labs all came back normal and no additional cultures or labs were done. The plan was simply to treat for everything and give enough medication to prevent any relapse.

Surviving the last two days and nights was a great mental feat. Each day someone came to give me a two hour break. Katie came Monday and Mariama came Tuesday. They are women I don’t know well but who immediately offered to help when they heard we were in the hospital.

Finally Wednesday arrived, Thuli received his last dose of antibiotics and I packed up our things. After a small internal debate decided that I could not leave without talking to Kezia’s mother. I made a list of everything I thought needed to happen in her care – daily weights, calculations for the calories she needed, checking the placement of her NG tube prior to each feed, checking for residual breast milk prior to each feed, having the mother exercise her joints, allowing her to suck the bottle for part of the feed rather than giving everything through the NG tube. I told her mother that I had been observing her care and had some thoughts about it and asked her if she would like me to speak to the doctor. I told her that I would not if she did not want me to. (Everyone knew by that point that I was a nurse.) She said she wanted me to talk him.

After rounds I asked the young doctor if I could speak to him for a few minutes and before leaving I told him that I did not want to intrude but I had had some thoughts about Kezia’s care. He was very receptive and when I finished going down my list, he asked me for my notes. I returned to Kezia’s mother and told her that I had talked with the doctor. She thanked me and we left.

It felt wonderful to be discharged. We were released from prison. When we got home around 1pm, Clement bathed Thuli while I took a shower and then we got into bed and did not get out until 7am the following morning. Now that Thuli had recovered and the rash had faded, my mind fixated on Kezia. I thought about her constantly. I did some research on the internet and created a sheet with formulas for the amount of calories needed, the volume of breast milk she should consume daily, and the expected daily and weekly weight gain. I wanted to return to check on her Thursday but I was still exhausted and did not want to return with Thuli, and Clement was writing exams. I wondered if I would regret not visiting.

That evening I came up with a plan. A visitor to another child on the ward had taken my number and had already called several times to check on Thulani. I called her and asked her whether she would take a letter for me to Kezia’s mother the following morning. She agreed. The next morning Becky came over and collected a letter I had written to Kezia’s mother along with the sheet of formulas. Becky told me that the mother was very poor and her friend had been sharing food with her so I added a few cedi and said a silent prayer. I then waited anxiously for feedback. After a few hours Becky called and said that Kezia had died and the mother had already left the hospital.

Here we are, grateful for Thulani’s recovery, and yet heart-broken after our bitter reminder of the unnecessary suffering that mothers and babies experience daily all over Africa in wards like Tec. Clement says this is why he wants to be a Pediatrician in Malawi, because children should not die like flies. This is why I became a midwife, to honor women and their children, to provide good care and let them know they are worth so much more than they are often allotted.

Wednesday, March 30, 2011

The Birthday of One Sweet Boy

We were 12 in my class of midwives and, though ranging in age from 23 to 58 and entering the program with vastly different life experiences, we became incredibly close. Every year since we graduated, as many of us as are able gather somewhere beautiful for a few days of retreat, stories, laughter, tears and wonderful togetherness.

Last summer we met in Santa Cruz and two of us were pregnant. The others organized a giving circle. They sat around us in a semi-circle and gave us flowers, massaged our feet, combed our hair, and then each midwife presented a bead to each of us. As they held the bead they told us why they chose it – representations of courage, strength, love, faith. They told us what they saw in us and what we should remember during birth. In the end we each had a colorful necklace and a warm full heart. I imagined myself in Ghana with my necklace, closing my eyes, sliding the beads between my fingers and invoking their presence. I did not imagine any of them physically by my side.

A few days after our retreat I spent an afternoon with Judith, my former midwifery instructor and dear friend. She is also the wise woman of the “seed of goodness” post and one of the great spiritual guides in my life. She asked whether any of my former classmates would come to the birth and when I said no she asked, “How about if I come?” I was thrilled with the idea but did not lose myself completely to the excitement because I did not want to be disappointed later. She said she would see if it were possible and we left it at that. A few months later Rita, one of my classmates, emailed to ask whether I would mind her coming for the birth. She was planning to take a break from her job and wanted to travel to Italy but thought the timing would work and she could pass through Ghana on her way. All I could think was, “What a ridiculous question!” Judith wrote a few weeks later to say that she would also come and the three of us emailed back and forth as arrangements were made.


Rita arrived in Ghana on February 11th. We spent a week in Kumasi, talking, catching up, waddling and wading through the market (an experience Rita agrees defies words and pictures), cooking, cleaning and sweating morning to night. Judith was scheduled to arrive at 5:15pm on Friday the 18th. I started feeling contractions on Monday the 14th and was slightly worried that the little boy would make his debut without Judith but we were all praying for him to wait and thankfully the contractions settled down. On Friday morning Rita and I cleaned house again and prepared a room for Judith. In the afternoon we walked to the nearby corner shop (about a 15 minute walk, most of the time) and on the way back I had to stop a couple times and breathe through contractions. When we reached the house we took a few more belly pictures with Clement and made food.

I received a call saying that the plane was delayed and would arrive at 6pm so at 5:30 I sent Rita by taxi to meet Judith. At that point the contractions were still a couple minutes apart but were gaining momentum so I called Ethel and Ernest – our former housemates. Ethel and Ernest had moved out within the previous week but wanted to be present for the birth (Ethel is expecting her first in April and wants me to deliver her here as well). I told them that the baby would probably be born sometime early the next morning and to come anytime. I also called Caterina a good Swiss friend who is married to a Ghanaian and has lived here for almost 20 years. She said she would come soon. Not long after Rita left Judith called to say that she was still in Accra, her flight was further delayed, and she would likely arrive around 7pm. I told her that Rita would meet her and I was contracting at home. Clement and I sat together on the couch, his hands and presence helping me through each contraction.

When Caterina arrived around 7pm I could still talk between contractions but had to close my eyes and breathe when they came. From there they accelerated quickly so that the interruptions in our conversation soon became the conversation and the power went out as if to emphasize the transition. Rita and Judith arrived at 8pm to a candle-lit scene of me contracting on the couch, with Caterina on my right and Clement on my left. I hugged Judith. She and Caterina introduced themselves. Judith sat down asked me what I had had to eat and drink, how the contractions were going, and then went to her room to change into scrubs (not at all acting like someone who had just reached the end of a 24 hour journey). I moved into the bedroom and kept my eyes mostly closed from then on.

I remember rocking and saying “Ayayayayayayayaye” with contractions. I remember opening my eyes at one point and seeing Ethel. It was hot and I wanted to get into the cold bath so as the tub filled I sat on the toilet but that seemed to intensify the pain so then I leaned over the edge until I could step into the half filled tub. I asked Clement to call Rex, my “just-in-case” OB and when he asked what he should say, I said, “Tell him I am DEFINITELY in active labor.” Rita later told me that she held her tongue at that point. No one had examined me and she had her doubts about how far along I really was. I only managed a couple contractions in the tub. I felt like I needed to open my legs as wide as possible during contractions and the tub was just too narrow. I headed back to the bedroom floor. Caterina had sewed a baby mattress as a gift to our little one and Rita wrapped that tiny mattress in a sheet of plastic and placed it on the floor for me.

I alternated between hands-and-knees and side-lying positions. Clement sat at my right shoulder, often holding my hand, and Judith at my hip, supporting and massaging my legs. I felt nauseous at the peak of contractions and eventually vomited all the water I had been drinking. Whenever the contractions came I would stretch out my hands and squeeze whoever’s hands met mine. I thought often of all the many stoic women I have attended in birth and I told myself to relax and open to the contractions but my muscles did not seem to comply. My legs shook involuntarily and I found comfort in squeezing hands as hard as I could.

During my pregnancy I gave myself permission to just be a woman and not a midwife during labor. I did not want to allow myself to think that being a midwife would give me any edge over the pain or the difficulty of the experience. While it is indeed comforting to have witnessed so many women successfully labor and birth, I wanted to use those memories only for the comfort and encouragement they offered and not as a standard to force on myself. I did not want to continually hear an internal voice of judgment or clinical assessment during labor. Even so, the midwife in me occasionally piped up with a few remarks. When a woman is around 7 or 8cm dilated she will often vomit and shake so even though I had not been laboring very long when I started shaking I was hopeful that I was nearing the end of first stage. Rita and Judith told me they would only check me when I asked to be examined and I really wanted to wait as long as possible to make sure the news would be good news so I just kept shaking and squeezing hands.

A short while later I approached my personal edge; the intensity of contractions continued increasing and the pauses in between seemed to vanish. Negative thoughts starting infiltrating my mind and the little internal midwife said “Good, another sign of approaching the end of the first stage.” I told Rita and Judith that I didn’t feel strong, I told them that I was afraid of second stage. Everyone in the room offered reassurance and I made it through a few more contractions. Often in labor when a woman is completely dilated (10cm) her contractions will seem to peter out and she will have a short break (maybe 30 minutes and occasionally more) before they start up again. I was waiting for this break and kept saying, “Dear God, I need a break please just a little break.” Judith, in a stroke of brilliance, asked, “Would you like a shot of morphine?” of course I said, “YES.” I kept my eyes closed and Judith said, “Ok, we’re getting it ready.” Then Rita gently touched my arm and said, “There, there is your shot.” When she said that my entire body relaxed completely just for a few minutes and it was wonderful.

The next time I reached my maximum and after a few involuntary pushes I asked Rita to check me. I knew the baby was still high and I worried about being much earlier in the process than I hoped. At 11:30pm Rita checked me and said I was 9.5cm dilated and had a bulging bag. She then quietly said to Judith, “She’s minus 2” which means the baby was still a bit high in my pelvis. Disappointed with the decent I said, “minus 2?!” and Judith said, “Hey, be glad you’re not just 4cm.” I had a couple more contractions on my side and then the pain became unbearable in that position so I hopped on my knees and with the next contraction gave a big push. The bag of water broke. I felt great relief and there were sounds of celebration from everyone. I put my arms around Clement for support. Judith and Rita moved to a corner to quietly discuss something and then with the next contraction I pushed again and felt him start to crown. I reached down and when I touched about 4 centimeters of scalp I called out, “He’s coming.” Judith immediately took up her spot on a stool behind me. Rita lay almost upside down with her hands on his head and coached me to slowly push him out. I heard Ethel and Caterina make sweet “aw” sounds and I knew we were almost there. I felt his shoulder come out and then Rita said, “Grab your baby,” and I reached down, pulled the rest of him free and brought him up to my chest. After a long wait and great expectation he was here at 11:50pm on February 18th 2011, weighing 9lbs 2oz (Rita thought the scale was broken and make us reweigh him) . . .


Thulani Michael Chiwaula.

I chose Thulani, which is pronounced “Tu-la-nee” and means “be calm” or “be comforted,” and Clement chose Michael in honor of my loving and supportive father.

When I was 12 someone told my class that they would give us a gift we could use throughout our lives. They said, “Whenever you feel stressed or overwhelmed take a deep breath, close your eyes and say to yourself, ‘Be still and know that I am Lord.” I have used this many times in my life and it always successfully reorients me as to what is significant and what is insignificant.

So here he is, our precious boy, Thulani, a living mantra to accompany us throughout a lifetime. Be calm. Be comforted. Be still and know that there is a greater source of love and energy flowing through all life always. Relinquish the burden of your falsely assumed control and trust, hope, and have faith.

Many many thanks to Judith and Rita, our midwife angels, who saw us safely across the big wide deep river, which is birth.



And, thanks to our dear friends, Caterina, Ethel and Ernest, who cheered us along our way.

Wednesday, February 16, 2011

Seed of Goodness

I have been silent for a very long time. I am on a journey which began almost a year ago. My hands have welcomed many babies into the world and today I am waiting to welcome one particular little boy into the world. I am 38 weeks pregnant.

For a long period in my life I thought I should not have children. I thought about all the things I would not be able to do, all the struggles, all the limitations. I love children but I have no illusions about how much work it is to raise a child.

I often thought of how pursuing my own dreams would mean less time with my children, how living the life I am choosing in Africa might mean my children would not benefit from the certain opportunities my parents had struggled to provide to me and my brother.

I often thought about dreams and sacrificing my dreams in order to raise children. I have seen many people sideline their dreams when they have children and then later burden their children with the pressure to own and pursue these unfulfilled dreams. Could I fulfill my dreams while raising children with enough security and freedom to let them follow theirs?

I thought a great deal about suffering. In Malawi I witnessed so much of life’s darkness and wondered why anyone should consciously invite new life into this world. This world is often a very hard place and no life concludes without intimate knowledge of pain and suffering. Could I invite an innocent being into this world knowing that accepting my invitation would eventually lead to suffering?

I thought about the competing needs of my child and of other children. If I prioritized my child I imagined I would have much less to give to others and there are so many people with needs already on this planet. And then, if we had a child with special needs, how could we provide for that child? How would we provide the best possible care to our child without marginalizing or abandoning our larger goal of striving to provide good care to the poor in Malawi?

I thought about my impact on this planet. I thought about the resources I consume in my privileged life and the resources my children will consume and how this will only increase the burden on fragile ecosystems of this beautiful planet.

I talked with my friends about the overwhelming love they feel for their children and I thought (perhaps naively) that I don’t need my own child to experience this love. I have certainly tasted this love at moments while holding a newborn in my hands. In those moments, standing in Bottom with the craze of the ward swirling around me I felt flooded by love and the desire to nurture and protect the small tender beautiful amazing life in my hands. I enjoy feeling that way about other people’s children. I enjoy feeling that the children I meet in the hospital and who I welcome into the world with my hands, and those who shout at me on the street also belong, in part, to me. I value this sense of responsibility to the children of strangers. Will I continue to feel this love once I have my own child? Will I want more for my child than I want for other people’s children?

These are the thoughts I had for years but at the age of 34 married to a wonderful man who yearned to be a father, I knew children were most likely in my future. Still I felt an urgent need for peace before taking the step towards motherhood. Over the years of debating the topic with many people, I have received much advice but nothing that validated a personal desire for children. A year ago I spoke with a wise older friend with no children. After listening to me for some time she simply said, “We must continue to bear goodness into the world and a child born in the midst of love is such a seed of goodness.”

I let her words sit quietly for some time. They did not silence the concerns long debated by my psyche but after a few months a new thought spontaneously arouse . . .

Inviting new life into the world is completely irrational, but it is also one of the most deeply hopeful acts possible.

Inviting life into the world is based on faith alone, not reason. For all the hardness and suffering life encompasses, the birth of new life – whether in the form of a baby, or a flower, or a tadpole – is the renewal of a promise; the answer to that act of hope. New life offers the world the opportunity to experience those moments in the labor ward, when love eclipses all else. Life is wondrous.

It would be infinitely better if people didn’t throw garbage in the streets, and act out of greed and jealousy, destroy, fight, and murder. But, somehow the depravity elevates the urgency with which we must attune ourselves to the astounding beauty around us and work towards change, and keep hoping. The conscious act of inviting a pregnancy is the manifestation of hope - that the world can be better, that we can as a species learn gentleness and compassion, that delicate life will be respected. It is a hope I did not know I was capable of until I let go. I opened myself and welcomed the possibility of life, relinquishing the illusion of control and honoring the source of perfection and hope, and promising to offer the best of myself.

Monday, April 26, 2010

Another Revolution of the Whirlwind

Another plane ride. Another long exhausting trip. So wonderful to step down from the plane to see the small familiar airport flanked by trees heavy with their yellow and red flowers, to see the miles and miles of green. So good to receive the welcoming hug of my friend Ruth who came to meet me. So good to be home again.

The Malawi I visited remained unchanged from the Malawi I remembered apart from one important detail. Thanks in great part to Dr Meguid and Rachel Macleod, Bottom Hospital is now the mere corpse of its former self. The new Bwaila sits 100 meters away on a grassy plot next to the new Bwaila HIV clinic. The maternity is a beautiful building with wide corridors, plenty of natural light, private rooms where women may labor with the company of their husband, mother, or sister, and three operating rooms. They are still conducting 1,000 deliveries monthly with few staff but hopefully the numbers and acuity will decline once the new KCH maternity opens a couple kilometers down the road. It made me gleeful to see the doors of Bottom locked.

I came to Malawi for a month to work on the nonprofit. Mrs Namaleu has been running everything on the ground – visiting babies and moms, buying supplies, trying to keep all the administrative pieces together. It is too much work for one person. It is really too much work for two people but two is an improvement. A couple of wonderful volunteers drive Mrs Namaleu to visit babies three mornings a week and this helps. The days when she does not have access to a volunteer’s car she spends too many precious hours in transit.

This year we received $25K from the Abbott Foundation to increase our home visits to postpartum moms. The money will provide 60 high risk postpartum women with 6 home visits by nurses after they are discharged from the hospital. The women visited are recovering from serious health complications or obstetric emergencies. All have been hospitalized for extended periods of time after delivery, some have spent time in the ICU. Their conditions include: severe anemia, uterine rupture, emergency hysterectomy, sepsis, AIDS & tuberculosis. The idea is that nurses will visit them in the home to monitor their recovery, assess and support them in the care of their newborn, provide health education, and mobilize their communities to support them. Usually, once women are discharged from the hospital no one conducts any follow up, and if they are still ill and weak, their return to an impoverished home with food instability sets the stage for a lapse in their own health and the deterioration of the health of their young children.

The goal of my trip was to help Mrs Namaleu get the new program up and running, help her with computerized tracking forms for our mother care and baby care programs, work with the new board of Chimwemwe mu’bereki (Joyful Motherhood) – the Malawian sister nonprofit to African Mothers Health Initiative, and do some local networking with the hope of developing partnerships or finding money.

The first day I spent with Mrs Namaleu passed without progress on our projects. This story is an example of the diversions of which there are way too many in Malawi. While visiting a friend the previous week, Mrs Namaleu’s daughter Chisomo met a young severely emaciated girl. When Chisomo returned home she asked her mother whether she could invite the girl to live with them. Mrs Namaleu said yes and Chisomo talked to E’s mother and then brought her home. E’s story soon unfolded. E’s mother was one of 11 children, she is Malawian but lived most of her life in Zambia. E and her younger sister were born and raised in Zambia. E’s father died, her maternal grandmother died and all 10 of her maternal aunts and uncles died. When E’s grandfather became critically ill in Malawi, E’s mother traveled to Malawi to care for him leaving her daughters in the care of distant relatives in Zambia. While her mother was away, E was raped by a man with AIDS. E sank into a deep depression, she lost weight and her health deteriorated. E’s grandfather died and her mother returned to find a nightmare awaiting her in Zambia. She collected her daughters and moved them to Malawi where she had met and recently married someone. When they returned to Malawi the man left E’s mother.

When Chisomo met E, E’s mother was pregnant and unemployed, the three of them were living hand to mouth often going hungry and E was quickly wasting away into nothing. When Chisomo brought E home, Mrs Namaleu escorted her directly to the hospital, for an HIV test and a chest x-ray, and then had her admitted. My first day with Mrs Namaleu we spent moving from hospital to clinic trying to get E started on TB treatment and registered at an HIV clinic. That day E was so weak she could barely sit upright, her stomach only tolerated a few spoonfuls of porridge at a time, and even through her clothes I could see the outline of her pelvis and every last rib. Over the course of the next few weeks, E began putting on a little weight her appetite and her smile returned. Her little sister who initially sat motionlessly for hours taking in everything with large terrified eyes also transformed into a joyful playful little girl. I was filled with hope when I left and re-inspired by Mrs Namaleu’s generous heart.

The entire month was a blur. The days were long and productive. This trip I only made a few visits with Mrs Namaleu because I was focused on administrative pieces, which she rarely has time to address. I missed the opportunity to visit many good friends and former patients. I left feeling that the time was too short but satisfied with our accomplishments, eager to create a home in Malawi, excited to return to Clement, and frustrated by my inability to participate at the same level from Ghana.

One visit I made with Mrs Namaleu for Chimwemwe mu’bereki was to see M and her triplets. For some unknown genetic reason there are many spontaneous multiples in Malawi. Mrs Namaleu said that during 2009 there were 26 sets of triplets born at Bwaila alone. It is not uncommon that in a set of triplets at least one of the babies dies during the course of infancy. Often triplets are delivered prematurely and rarely does a mother produce sufficient breast milk to support the growth of three healthy babies. For the reason of their increased vulnerability, Chimwemwe mu’berei visits and supports several sets of triplets. The morning we visited M, Mrs Namaleu and I boarded a minibus to Mitundu for 150MK ($1) each and walked a few meters from where we dropped to reach M's house. Most of the mothers and babies we visit do not live within such easy access of public transportation. Unfortunately, in her case, even this short journey rendered the hospital all but in accessible. M’s story illustrates all the layers of suffering and poverty which may ultimately result in the death of a woman or her newborn. All isolated interventions are insufficient but in spite of our inadequacy in finding a comprehensive solution to all, we must not sit back and feel overwhelmed, because M and women like her have no time to indulge debates or pity, they must simply wake up and struggle to survive another day.

This is M’s story. M had three children born in 1997, 1998, and 1999. At some point she divorced and was left alone to care for her children. A few years later her sister died and left her own three children in her care. M is not educated. She has no job other than working in the farm and house, growing food for survival. Her grandmother died, her parents died, all of her aunts and uncles died so at some point she also took on the care of her elderly grandfather. M remarried and soon after became pregnant. Her belly grew faster than expected and when her husband understood that she might deliver more than one baby, he abandoned her. M continued with her work in the fields and the home throughout her pregnancy. There was no money to pay for school fees or school uniforms, so the older children stayed home and worked alongside her.

One morning when she was about 8 months pregnant she rose early went to work in the field then returned to the house and swept the packed earth floor inside and out. She collected a bucket to draw water and walked to the bore hole but as she pumped the water she felt something trickling down her leg and realized that she needed to get the hospital. She did not have the 150MK for transport so she tried to borrow money from neighbors, offering to give them a cloth to keep as collateral. Everyone refused. She lived 14 kilometers from Bwaila and she began to walk. She only managed to walk a few kilometers before the labor pains accelerated and she looked for a place to lie down. There was a farm on the side of the road and she saw women working nearby. She headed towards them. They saw her and immediately assessed her situation. They spread a few sheets of plastic over the bare earth for her to lie on and there she delivered three premature babies. She was lucky that the babies came without complications, that they were positioned correctly, that the placenta also came at the right time, that she did not bleed excessively. The women helped clean her and bundle her babies in old rags. Exhausted, she sat there in the field under a tree until evening. Someone contacted a friend with a car who lived in the area and when he returned home from work that evening, he collected M and her three babies from under the tree and drove them to Bwaila.

Mrs Namaleu met M and her babies at Bwaila. The babies are now 6 weeks old, they are tiny and fragile but healthy. M continues to do most of the work in the field and the house. She eats little and her breasts are dry. She said that she eats nsmia (maize flour) and if she has 20 MK ($0.14) she buys a little tomato to eat with the nsima. When she returned from the hospital her grandfather generously offered to exchange his large 10 x 15ft house of unbaked mud bricks with a thatch roof for her 8 x 8 ft unbaked brick house with a leaky roof. We give M formula for her babies, we remind her about kangaroo care – how to tie two babies at a time skin to skin between her breasts, we talk to her about malaria prevention and signs of illness. The babies have a long road ahead of them and so does M.

During my month in Malawi I made two personal excursions. My second weekend there I headed to James Village in Salima to visit Clement’s mom. A friend gave me a ride and I filled the car with bags of groceries – sugar, salt, tea, soap, toothpaste, Vaseline, cooking oil, mosquito repellant, cookies, tomatoes, and onions. Ironically this time of the year - when a carpet of lush green covers the brown earth and the gardens fill with plants tall enough to conceal the famers - is often the time of hunger. A portion of the crops are always sold for cash and the remainder of the harvest slowly dwindles through the year to almost nothing, so people go hungry watching the maize mature on the stalks.

As we approached the village, I bought four large fish from a fisherman standing on the roadside and he slung them over the side view mirror by a thick blade of grass woven through their gills. We turned off from the main road and navigated the 6 kilometers of dirt roads to the village but I had never previously visited in the rainy season and I barely recognized the house with all the grass towering overhead transforming the landscape. I saw Clement’s grandmother first and as I stepped down his mother, William, and his youngest brother Felix came to meet me with open arms and bright smiles. A group of children gathered around the car as we unloaded and I handed them a couple packages of cookies, which were devoured instantly. The empty boxes remained with them, passing between them for the next two days as lingering proof of their ephemeral enjoyment.

Clement’s mother had killed a goat and a few men were working on skinning it. They gave a leg to my friend who received it happily then left. Clement’s mother was left with three adult goats and two kids with their dried umbilical cords still protruding from their bellies. As Clement's mom prepared nsima I sat in a chair in the shade talking with William who came from Mangochi to visit his mom and serve as my translator. That afternoon we ate one of the fish. It was delicious and I was thrilled that Clement’s mom, stepdad, and Felix ate and ate until all that remained was a small pile of bones.

William and I walked through the farms around ponds of mud while his grandmother and mother prepared the remaining fish for drying and placed it on the thatch roof in the sun. When we returned William cut the goat into long strips, carefully draped it across sticks placed over red coals, and grilled it slowly. As he removed the meat, Clement’s mom shared small bites between us and the handful of children standing nearby watching both me and the meat with equal interest. Towards evening a light rain fell in interrupted showers. William and his grandmother continued their vigil at the fire under an umbrella. The sun set. The entire time Clement’s mother worked. She only sits to eat and the rest of the time she is in motion, drawing water, cooking, washing, preparing bathwater, sweeping, moving the goats to fresh grass, shooing the dogs, preparing the house for sleep. In the light of the lantern we ate our dinner of nsima and goat stomach wrapped in intestine. There is no place for finicky eating in the village. Food is always a blessing, so I always eat what is set before me and in spite of my cultural inhibitions I always enjoy the food.

In my own life there have been few moments characterized by a pervasive sense of peace and yet this is what I feel every time I visit Clement’s mom or dad. Safe. Loved. Calm. No phone. No email. No obligations. No pressing list of tasks to accomplish. No humming or whirring of inanimate objects. No electricity. No cars driving by reminding me of the pace I must soon resume. There are only the quiet sounds of people and animals bedding down for the night; the sounds of the birds in the day and the insects at night. There is only time divided by the paths of the sun and the moon. There are only the people who are with me. There is nothing I have to be besides who I am in the present moment. I look forward to this retreat from my otherwise overcrowded restless mind.

Unfortunately, despite the deep contentment, I never sleep well in Salima. Despite all the cloths and blankets Clement’s mom piles for me on top of the grass mat, I am too aware of my angles against the hard floor. I sleep in fits and starts. Early in the morning, before the sun rose and before I woke, Clement’s mother, lying beside, me began telling stories to William and Felix in the next room. In my semi-conscious state the words, their rhythm, even their mother's accent were so familiar as though meaning was just slightly obscured by the haze of the fading dream, like something I once knew well. She told them about a hyena circling the building with their grandmother sleeping inside. She told them about how they used to get sick as children. There was more and they laughed but as I rose from sleep and tried to decipher her words the stories slipped away.

Once we were up Clement’s mom told me she would go draw water and I said I would come and help. She laughed. She took the large metal pail and gave me a smaller plastic bucket. I watched her jump up and down to pump the water and fill the pail. I imitated her and filled my own. My heart raced from the exertion. She helped me lift the full bucket to my head. It was heavy and I was grateful for the relatively short walk back to the house. Focusing on not sloshing the water, I told her I would walk slowly and she zoomed by laughing, making me laugh, the neighbors also laughed as I walk by.

The morning passed and the visit ended. Clement’s stepdad James carried me on the back of his bicycle the 6km to the road and then waited with me as I dozed, sitting on the curb with my head on my knees, waiting for a bus. Within a half an hour a large coach bus bound for Lilongwe stopped. James ran for the door to block others from scrambling in ahead of me. I boarded and took the first seat available just behind the conductor. The people near me wanted to know what I was doing in the middle of nowhere and they laughed when I told them I was visiting my “apongozi” (in-laws).

On the way back to Lilongwe I wondered if I had even seen a more beautiful place with such vivid colors - miles and miles of open land, dark purple clouds hung like drapes over small villages and deep green fields.

My love for Malawi mingles and grows with my love for Clement. I cannot tell where one ends and the other begins. I can only feel my heart fill to bursting.

* * *

During my last weekend in Malawi I headed to Mangochi to visit Clement’s dad. Mangochi is the small lakeside Southern Malawian town where we married, where bicycles outnumber cars 10 to 1. There are just a few paved roads and a maze of sand roads and paths around houses which change seasonally as people erect and demolish grass fences. Clement’s dad met me at the bus stop in town and we walked back to the house along a new path through the maze, his dad pausing occasionally to greet adults and children alike. I spent a lovely evening with Clement’s sister Effie, William, their grandmother, and dad. We laughed and talked and ate a meal of nsima, fish and pumpkin leaves (everyone knows pumpkin leaves are my favorite).
The following morning Clement’s dad accompanied me to Chiwaula Village to visit the extended family; everyone in the village is related either by marriage or blood. We made the rounds and at one point as we sat on a large fishing net spread on the ground under the mango trees, Mr Chiwaula told me that he was asking his aunt about a sick cousin living nearby who delivered a baby in November. The baby died shortly after birth and the mother’s health quickly deteriorated. He told his aunt he would visit her and asked me if I would like to join him, which of course I did. We found S lying in a shady spot outside on a grass mat. I walked directly to her, touched her shoulder and her face. She was breathing quickly and burning up. I stroked her arm and placed my hand over hers. She took my hand without looking at me. I told Mr. Chiwaula that we must take her to the hospital immediately that she could not wait another day. Her mother brought me her health passport and I saw that she had visited the hospital several times since November. She was HIV positive and was put on antibiotics but not started on ARVs. There were instructions to return after three months for a CD4 count. Looking at her it was obvious that she had full blown AIDS and hearing her cough I knew she most likely had tuberculosis as well. There was no longer any need for a CD4 count.

Mr Chiwaula waited outside the fence as we, the women, helped her sit and dress. Though clearly she was once a beautiful woman that day she was little more than a skeleton with a distended abdomen (this is common in TB patients) and every movement exhausted her. Slowly step by step, supported between two people, she walked the 100 meters to the road and we waited for a vehicle to pass. A truck eventually stopped. Several people lifted her into the passenger seat and instructed me to sit next to her. Mr Chiwaula and her mother climbed into the back. I held her hand and she rested her head on my shoulder. I felt completely possessed by an overwhelming love for her and desire to protect her. Death hovered nearby.

When we arrived at the hospital I easily lifted her down from the cab in my arms. Mr Chiwaula found a wheelchair and we headed to the office of the clinical officer seeing patients. There I explained her history and gave him her health passport. He examined her, admitted her, and ordered several labs: Hb, tuberculosis sputum test, CD4, malaria. She was pale and he wrote for two pints of blood if her Hb was less than 7. When we reached the ward the nurse stuck S her several times to place the IV. She drew blood and gave her quinine. I was skeptical about the urgency (or lack thereof) with which the care would be carried out and knew hope depended on quick initiation of TB treatment. When a person with AIDS suffers from a co-morbidity it is always necessary to begin treatment of the co-morbidity first before beginning ARVs. Otherwise, as the immune system begins functioning again, with assistance from the ARVs, it becomes completely overwhelmed by the disease and the individual quickly dies. The only treatment S received in our presence was for malaria, it was precautionary as malaria is endemic and deadly and any fever may be a sign of malaria, but no one really believed S had malaria. We helped her settle into the bed and left her with her anxious mother watching over her. On our way out we greeted another relative from the village, a young woman whose foot had been bitten off by a crocodile. She and her mother smiled warmly.

By the time we reached the house Fatsani, Clement’s best friend, had arrived with his fiancĂ©, Lides. Fatsani and Clement were inseparable when I met them in 2005 and Fatsani quickly became a dear friend to me as well. It is Fatsani’s nature to make people laugh, and he excels in this to the extent that his pavlovian smile results in peals of laughter and aching bellies. But, apart from his geniality he is also a loyal friend with a compassionate heart.

Typically, in Malawi whenever a couple has disagreements or difficulties they seek the advice of an uncle. Since I had no accessible uncle, early in my relationship with Clement, Fatsani said he wanted to see us “go far” asked if he could be the uncle. I laughed and agreed not perceiving Fatsani’s earnestness behind his smile. Over the next two years, Fatsani did the job well, telling Clement when he was being stupid and me when I was being stubborn, always mending things gently with his smile, which melted our hearts and soothed our tempers faster than we could have on our own. Fatsani was the best man at our wedding. On this trip Fatsani came to Mangochi for the explicit purpose of introducing me to Lides and I instantly liked her – her lovely smile and sweet laugh excellent qualities for the woman of his life.

Feeling unsettled about S, I told Fatsani the story (Fatsani is a clinical officer and Lides is a nurse) and was pleased, though not surprised, to learn that Fatsani knew a clinical officer at the Mangohci District Hospital. In public hospitals in Malawi where resources are short and the staff overburden and overworked, a personal connection to a nurse or doctor can make all the difference.

Once the sun set Fatsani, Lides, Mr Chiwaula and I walked back to the hospital with a flashlight through the dark. At the hospital Fatsani happened to know the nurse on the women's ward from secondary school. They spent a few minutes laughing and reviving old memories before he explained his connection to S and asked for the update. The nurse said that she decided that the patient was pink enough to wait to run the Hb in the morning (on the weekend the lab technician must be called in from home for emergent tests) and explained that the other labs would take a few days. We found S as we left her, which worried me. She did not have a few days. We searched for the clinical officer and not finding him in the hospital we went to his house and learned that he had just left. Fatsani wrote a note and gave it to his housemate.

Sunday morning I woke early and walked to church with William. St Augustine’s is the church where Clement and I married. It is humble and beautiful. Simple wooden benches lead to the altar, lattice brick walls invite sunlight to fill the space and fresh air to circulate, colorful murals narrate Biblical passages, and the choir fills both the church and the surrounding area with beautiful Malawian music. I prayed for S and absorbed the peace.

When we returned to the house Fatsani said that he and Mr. Chiwaula had already been to the hospital, visited S, and met with his clinical officer friend to discuss her care. I felt enormously reassured. We spent the morning, chatting, laughing, taking pictures and then said our goodbyes. Effie, Fatsani, Lides and I boarded minibuses; each of us heading back to homes in different directions. The following day my personal whirlwind accelerated again and I left Malawi.

* * *

From Lilongwe, Malawi I flew to Nairobi, Kenya. I spent one night in Nairobi and then flew to Ghana the following morning. In Nairobi I went through immigration, paid for a 24 hour visa, took the bus to the nice hotel, ate a very good meal and then called Haron.

Haron drove the Kenya Airlines shuttle that took me from the hotel to the airport in November 2008. On that trip I only realized once I arrived in Nairobi that the travel agent in Kumasi, Ghana had forgotten to give me a hotel voucher (the airline is supposed to cover the cost of a night in a hotel or more accurately said, they are supposed to allow you to access the fee hidden in the cost of your ticket). The airline representatives in Nairobi said they could do nothing without the voucher, so I changed money and spent a few hours emailing and calling Clement until he was able to get in touch with the travel agent in Kumasi who then wrote out and scanned me a voucher. As a result I had about $15 or $20 worth of Kenyan Shillings in my pocket the morning of my flight to Ghana.

Haron collected me from the hotel at 5am. Alone in the van I asked him about his family, his children, his job, and his farm. Haron looks younger than his 30 years and he smiles easily, especially when talking about his family but, when I asked about his farm he became serious and said that he needed a couple more bags of fertilizer and was not sure how he would afford them since he had already purchased as much of the subsidized fertilizer as he was allowed. I asked him how much he needed and he told me. It was almost the exact amount of money I had in my pocket so I put it all in his hand. For a moment he was completely shocked and then incredibly grateful. He promised to keep in touch and told me that he was an artist and he would make something for me. Our interaction left me feeling high and instantly put a different spin on the frustrations of the previous night.

Haron kept his promise. He occasionally emailed me a line or two, he sent me pictures of his children, and he repeatedly asked for an address. For a year we had no mailing address in Ghana and when I finally sent him the address, he said he had no money to mail the art. When Clement flew last summer, he did not have a layover in Nairobi so this trip was the first opportunity to reconnect with Haron. I had emailed him a few days before my flight but the morning of my departure from Lilongwe I mixed up the flight time and left in a rush without contacting him again.

It was after 8pm when I finally looked up his number and called him from the Panari Hotel in Nairobi and just by chance he happened to be downstairs in the parking lot. It was great to see him. Though I had actually forgotten what he looked like, he gave me the hug of an old friend. He told me that his wife and children had been waiting for me at home and would be disappointed that I could not visit them. He showed me their pictures. He asked about Clement. He told me that we should find time to come for a few days so that he could show us around. He asked me why we didn’t yet have a baby and told me both with concern and joy – from his personal experience of fatherhood – that we must have a baby soon. He said he would come and collect me in the morning so that he could give me the art and so that I could show him pictures from our life.

At 6:20 the next morning Haron pulled up in the Kenya Airlines van and helped me load my stuff in the back. When we arrived at the airport we parked for a few minutes and I showed him the pictures of Clement and of Malawi and Ghana. It was great. He gave me what he had created and had been holding on to for so long. He handed me a piece of wood – about the size and weight of a large cutting board – that had been painted black. He had hammered nails into this, painted them, and then woven colored thread between them, resulting in an asymmetrical heart on one side and a red and yellow flower the other, and between them the words: Baibe 4 you I will. Haron said I should give it to Clement and it should be for us. It was clearly made with genuine thoughtfulness. It makes me laugh each time I see it. I love it. I carried it through the airport in a plastic bag but of course whenever I put it through the security scanners the security people removed it from the bag. I was surprised by how much they admired it.

Once again I am awed by the gratitude. I gave Haron $15. I would have been happy if he had quietly bought his fertilizer and never contacted me again but when I told him I had doubted that he would email, he was shocked. When I asked him whether he has many friends from all over the world since he has so much contact with foreigners, he said, “No, you and Clement are the only ones.” A short conversation and fifteen dollars.

This series of events is not one life has taught me to expect. I am accustomed to promises and generous intentions without further action. Unfortunately this is also my own pattern all too frequently. How many countless times have I said,” I will visit you,” “I will call” “I will write” and only remembered long after the appointed time. When others make similar promises to me, I have learned to be grateful for the intention and not to expect more. When promises are fulfilled it is often a new wonderful unexpected gift.

It is sad that this is the norm. We are too busy to pay attention; too busy to remember. Many of us are imprisoned by our own stories and they blind us to the abundant blessings around us. Or, we are too focused on “how the world has been unjust to me” and our sense of entitlement to be rocked by gratitude.

Life is teaching me a new pattern. Again and again in Africa I have been awed by the profound expression of gratitude. Again and again a simple act on my part, opens the flood gates of kindness and generosity which way exceed the original act. Most of the people who have responded thus are poor but I am certain that an individual’s economic status does not directly correlate with their ability to express gratitude. Gratitude like optimism and compassion is a character trait; one which most of us could work on developing a bit more.

The plane to Accra was delayed, first for one hour, then another, then indefinitely; indefinitely turned out to mean 6 hours. Originally we were supposed to arrive in Accra at noon and I had planned to board a bus and be in Kumasi by 7pm. But, as the plane began to descend it was already seven and the sky was dark. As the flight attendants prepared for landing I starting talking to the man sitting next to me. Daniel was returning from a work trip to Gabon. He is a young Ghanaian engineer working for a large cyber technology company. As it turned out he had attended KNUST (the University where Clement attends medical school) and when I told him that I would take the bus to Kumasi the same night he insisted on driving me across town to the bus station.

On his layover in Nairobi he had met a Ugandan priest who was coming to visit a friend in Accra. Daniel had spent a couple years in Uganda so when they came together again as we disembarked they seemed like old friends. Daniel and I passed through immigration first and then he moved between me and the priest, making sure the priest got his visa, making sure I had collected my bags. I kept saying to myself this would never happen in the US.

His friend who met us with the car initially seemed slightly disappointed by the extra passenger - there was a big premier league football match starting in a few minutes and he had planned to go directly from the airport to a television. But soon enough he transformed into a very gracious driver and engaged me in a lively conversation on marriage and monogamy (I’ll leave the out details). The traffic in Accra is unbelievable; it took us nearly an hour to get from the airport to the bus station. Every now and then as we crept forward and the car’s digital clock flicked through minutes I would apologize and lament the fact that they were missing their game but they would just brush my comments aside and dive back into the discussion. Once, Daniel said dismissively, “You would do the same for me.” I smiled guiltily. I could not imagine many Americans driving a complete stranger across town just because it was dark. I told myself, “You better start now!” When we arrived at the bus station, Daniel walked with me to buy my ticket and waited until my luggage was loaded on the bus. He gave me his card and then they were gone.

After the compulsory three hour wait for the bus to fill and the 5 plus hour journey it was around 4am when we arrived in Kumasi. I hired a taxi and borrowed the driver’s phone to call Clement. He had just dozed while waiting for me. Back to the light of his smile - my other home. Reunions are wonderful.

* * *

Clement and I called his dad on Wednesday just to check in and let him know that I had arrived in Ghana. He told us that S died on Tuesday and that everyone was grateful for what I did, he said that she never received any medication. What nonsense.