For the Love of Craig

I met my brother in 1980 on a cold January day at a foster home in Detroit. I had been waiting for him as far back as my four-year-old memory extended. I remember the joy, the anticipation, and the immediate sense of protectiveness seeing him among the other children in the house. Later, I remember him on the car ride home, his little blue hat and scarf meeting to obscure my view of his sleeping face. No one knew then that inside my peaceful 10-month old brother was a dormant force which would eventually claim his life. Our siblinghood took off from there. Energetic was a euphemism for his behavior in childhood. We played. We fought. We found our own paths. We grew in proximity, together and apart and together again. I moved across country for college and hardly looked back. I traveled the world, attended nursing school and became a midwife. He stayed in Austin, where we were raised, worked as a mechanic tec in local garages. I found my joy being with women, listening and supporting them through the adventure of birth. He found his with grease on his hands, deep in the mechanical bowels of cars. When he was in his mid-twenties, I started to become aware of something changing him from within. He twitched when standing or sitting still. I saw him awkwardly kick out his leg when bending to pick something up. He said he had back pain. I left for Africa. When I returned home for a visit, he was living with our parents. He had failed to tighten something important on a car and lost his job. He dropped things. He banged things. The twitching worsened. His toes moved as though they were playing the piano. People around us whispered accusations of drug use. He denied it. I made a long list of neurological diseases and started crossing them off. I requested his medical records from the various doctors he had seen over the previous decade. We searched for his birth parents. We found the death certificate of his mother. She had died at 40. He was 13. Typed on the line beside “Cause of Death” sat the ominous words “Cerebellum Degenerative;” not a true diagnosis but a clue. I returned to Africa. I had my first baby. At that point I had been a midwife for seven years. I had helped hundreds of women during their births. My midwife told me that labor was like a wide river that you had to cross. There were women on the other side cheering you on, but the journey was yours alone. It was hard. It was amazing. I reached the point when panic threatened to through me off course. I had incredible people with me cheering me along and I made it. I kept my eyes closed for hours but whenever I reached out my hand, someone grabbed it and steadied me. A few months later our dad took him to a neurologist who, after an hour’s evaluation, said he thought it was Huntington’s Disease. My brother, who rarely found a reason to be online, spent hours in front of the computer, pouring over stories and statistics which he synthesized and reported stoically as an assortment of lurid and distressing facts. · The life expectation for Huntington's patients is 10-15 years after the onset of symptoms · Huntington’s patients often die from choking, suicide and pneumonia · Huntington’s is known as the Dancing Disease, it is also often called the cruelest disease · If one parent has it, the child has a 50% chance of inheriting it · The course of the disease experienced by an affected person is often similar to that experienced by their affected parent · Huntington’s Disease is caused by an abnormal number of repeats of the CAG trinucleotide on the HTT gene. CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG These facts registered viscerally. I watched him and suddenly I could hear his demon laughing CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG. On August 31, 2011 a social worker wearing an uncomfortable smile in a room full of people named his demon. Forty-one laughs. That was the only time I saw him cry. Knowing made nothing easier. He was 32. Life continued, at that time mine was mostly in Africa. During my visits home I watched the demon beat out its own rhythm in his body, transforming his walk into a grotesque dance to silent music, arms flying, legs stepping high, body careening wildly. I saw the holes punched in the walls, made when the demonic force would fling him unexpectedly across a room. More than once I heard the thuds of his body as that force shoved his muscular six-foot frame down the stairs or knocked him over in the shower. I saw the bruises on his face and cuts on his arms from the beatings he never knew were coming. I watched the demon throw his food on the floor at the last moment as he lifted his spoon to his mouth. His room was moved downstairs, grab bars were installed. While I was home, I helped him eat and shower. He stopped reading and talking about Huntington’s Disease. He was living it. His depression was dark and I did not know how to add light. I returned to Africa. I had another baby. Labor was still hard. My midwife whispered in my ear, “Don’t be afraid.” My husband brushed my hair and rubbed my feet. My body felt it might tear in two and then our baby came gently into the world. At some point Dad knew my brother could no longer live at home and he was moved into a nursing home two hours from Austin. The transition was difficult. He was angry and the facilities (he moved 3 times) always struggled to care for him. He was not like most of their other patients. He was young, and mentally alert, and unwilling to submit to routines. Over time his speech deteriorated. It took effort for him to form words; communication demanded time and patience from those listening. Those who were short on patience assumed he was demented or developmentally delayed, and in turn, he would resist their care with everything he had. Those who had patience were rewarded with his elusive smile. Over time he walked less and less. His sentences gradually shortened to one or two words. Even “yes” and “no” became difficult to understand. I returned to Texas in 2014 with my family and saw him more frequently. I would tease him to see a smile. I would take him outside, light his cigarettes and hold them while he smoked. (When he entered the first nursing home, he resumed smoking after a ten-year break. He said the big H would get him before the big C.) I would cut his hair and wash his face. Apart from “yes” and “no.” He would say, “Thank you.” Every time I offered him a bite of food, he would say, “Thank you.” That always hit me in my heart. In 2017 he moved to a nursing home in Austin and dad started visiting him daily. I visited weekly. In early 2020 he lost his voice entirely. They gave him a speech device. He could touch, “yes” or “no” and phrases like “I want to smoke,” “I miss you,” and “I want thickened juice.” Swallowing was a problem; each bite and sip held both life-sustaining and life-threatening potential. The violent coughing fits from mis-swallowed sips instantly brought tears and fear to his eyes. In early March they told us they would be closing the nursing home to visitors indefinitely due to Covid. That night I came straight from work, I punched in the security code at 9pm and made my way to his room. I cut his hair and his nails. I straightened his room while he slept and kissed his forehead. He would be 41 in a week. In the time we couldn’t visit I thought about him and his life, about the hardness, the misunderstandings. I thought about his birth mother, Margaret Pohl. She was 28 when he was born. The adoption was closed, but our mother knew that Margaret had had a hard time giving him up. The story was that she dropped him off and returned to retrieve him several times from the foster family before she finally left for good. She must have been symptomatic. She must have known. She must have had a parent who suffered the same. She must have witnessed the disease. She must have struggled with love; wanting to keep him in her arms and knowing that if she did, he would witness her personal accelerating tragedy and ultimately end up orphaned. I imagine she prayed that he would be adopted into a loving family. I wonder if that hope gave her comfort through the years spent fighting her unwinnable fight. I wondered if we did right by her. She would want him to have a peaceful death and leave this life loved. I also thought of Judith and Maggie, two guiding lights for me. Midwife and hospice nurse, both in their 70s, dear friends who spoke of the parallels between caring for those entering and leaving this life. From March to August Dad and I saw him over video calls and talked to the nurses. His weight dropped from 141 to 132 to 125 to 118 to 114. I worried that he would die alone. We prayed for a good death. On August 31st the facility called to say his we could visit, his weight was 105, they thought he had days left. Hours later the hospice nurse said, “Come now!” Dad and I arrived together. His head was tilted back over the pillow, his mouth gaping, his eyes open staring at nothing. He was skin pulled over bone. I kissed the familiar scar on his forehead. I felt the worlds touching. As I held his hands, his purple fingers weakly squeezed mine. Dad sat at his side with his hand on his arm. We called the priest who came and blessed him and prayed. I thought of laboring women moving through transition. I thought of my experience. I dimed the lights, turned on soft music and the diffuser. He tried to adjust himself and I saw the anxiety in his face. An aide helped me straighten his body and his tension eased. I brushed his hair. When the anxiety creased his brow again, I whispered, “I love you” in his ear. The journeys of birth and death mirror each other; they provide the punctuation and symmetry of life. For both, there is no option but complete surrender. Both must be traversed alone, but both are easier completed with hands to hold. I felt swept up into an all-consuming love. In the same way I know a woman will make it through, just when she feels her body will break in half, I felt certain this was a transition to something good. He needed us to keep him steady. “You will be okay, Craig, relax into the love.” We sat there holding him as his breathing slowed. And then he was gone. I put my ear to his chest and kissed his scar one last time. He died August 31, 2020.